Что такое сульфорафан? | Эль-Пасо, Техас Доктор хиропрактики
Д-р Алекс Хименес, хиропрактик Эль Пасо
Надеюсь, вам понравились наши сообщения в блогах по различным темам, связанным с здоровьем, питанием и травмой. Пожалуйста, не стесняйтесь звонить нам или мне, если у вас есть вопросы, когда возникает необходимость обратиться за медицинской помощью. Позвоните в офис или я. Офис 915-850-0900 - Ячейка 915-540-8444 Отличные отзывы. Д-р J

Sulforaphane является фитохимическим веществом в составе изотиоцианатной группы органосульфовых соединений, обнаруженной в крестоцветных овощах, таких как брокколи, капуста, цветная капуста и брюссельская капуста. Его также можно найти в бок-чой, капусте, воротах, горчичной зелени и кресс-салате. Исследования показали, что сульфорафан может помочь предотвратить различные виды рака активизация производства Nrf2, или фактор фактора эритроидного фактора, связанный с ядерным фактором 2, фактор транскрипции, который регулирует защитные антиоксидантные механизмы, которые контролируют реакцию клетки на окислители. Целью следующей статьи является описание функции сульфорафана.

Абстрактные

Антиоксидантная система KEAP1-Nrf2-ARE является основным средством, с помощью которого клетки реагируют на окислительные и ксенобиотические стрессы. Сульфорафан (SFN), электрофильный изотиоцианат, полученный из крестоцветных овощей, активирует путь KEAP1-Nrf2-ARE и стал молекулой, представляющей интерес для лечения заболеваний, при которых хронический окислительный стресс играет важную этиологическую роль. Мы демонстрируем здесь, что митохондрии культивируемых эпителиальных клеток пигментного эпителия человека (RPE-1) человека, обработанные SFN, подвергаются гиперфузии, которая не зависит ни от Nrf2, ни от его цитоплазматического ингибитора KEAP1. Сообщается, что митохондриальное слияние является цитопротективным путем ингибирования образования пор в митохондриях во время апоптоза, и в соответствии с этим мы показываем независимую от Nrf2 цитозащиту клеток, обработанных SFN, подверженных апоптозу-индуктору, ставроспорину. Механически SFN смягчает вербовку и / или удерживание растворимого фактора деления Drp1 до митохондрий и пероксисом, но не влияет на общее содержание Drp1. Эти данные показывают, что полезные свойства SFN простираются за пределы активации системы KEAP1-Nrf2-ARE и требуют дальнейшего опроса, учитывая текущее использование этого агента в нескольких клинических испытаниях.

Ключевые слова: Сульфорафан, Nrf2, Drp1, Митохондрии, Деление, Слияние, Апоптоз

Введение

Сульфорафан является независимым от Nrf2 ингибитором митохондриального деления

Сульфорафан (SFN) представляет собой изотиоцианатное соединение, полученное в рационе, чаще всего из крестоцветных овощей [56]. Он генерируется в растениях как ксенобиотический ответ на хищничество посредством везикулярного высвобождения гидролитического фермента мирозиназы из поврежденных клеток; этот фермент превращает глюкозинолаты в изотиоцианы [42]. За последние два десятилетия SFN был широко охарактеризован по показателям противоопухолевого, антиоксидантного и противомикробного свойств [57]. Большая часть этой эффективности объяснялась способностью SFN модулировать сигнальный путь ответа KEAP1-Nrf2-антиокислитель (ARE), хотя были идентифицированы дополнительные активности соединения, включая ингибирование активности гистондезацетилазы и прогрессирования клеточного цикла [ 29]. Nrf2 является основным антиоксидантным транскрипционным фактором, и в условиях гомеостаза его устойчивость подавляется через действие цитоплазматического комплекса убихитин-лигазы Cullin3KEAP1 [20]. В частности, Nrf2 завербовывают в лигазу Cullin3KEAP1 путем связывания с адаптером димерного субстрата KEAP1 и затем модифицируют цепями polyUb, которые нацелены на фактор транскрипции для деградации, опосредованной протеасомой. Этот конститутивный оборот ограничивает период полураспада Nrf2 в ненапряженных ячейках до ~ 15 min [30], [33], [46], [55]. В ответ на многочисленные типы стресса, особенно окислительный стресс, KEAP1, богатый цистеином белок, действует как окислительно-восстановительный датчик, а окислительная модификация критических цистеинов, в частности C151, KEAP1 диссоциирует Nrf2-KEAP1 из CUL3, тем самым предотвращая деградацию Nrf2 [ 8], [20], [55]. Примечательно, что SFN и, возможно, другие активаторы Nrf2, имитируют окислительный стресс, изменяя C151 KEAP1, например [21]. Стабилизация Nrf2 позволяет транслоцировать ее в ядро, где оно индуцирует экспрессию батареи генов антиоксиданта и детоксикации фазы II. Nrf2 связывается с элементами промотора антиоксидантного ответа (ARE) его родственных генов-мишеней посредством гетеродимеризации с малыми белками Maf [19]. Эта система представляет динамический и чувствительный ответ на косвенные антиоксиданты, такие как SFN, свободные радикалы, генерируемые митохондриями [16] или другими физиологическими источниками окислительного стресса [41].

Митохондрии представляют собой динамические субклеточные органеллы, которые регулируют множество клеточных функций, начиная от производства АТФ и внутриклеточной кальциевой буферизации до редокс-регуляции и апоптоза [13], [49]. Митохондрии также являются основным источником реакционноспособных видов кислорода (ROS) внутри клетки. Поэтому правильное регулирование функции митохондрий необходимо для оптимизации производства АТФ для удовлетворения потребностей сотовой связи, одновременно минимизируя потенциально вредные последствия чрезмерного производства свободных радикалов. Критическим требованием для тонкой модуляции функции митохондрий является способность митохондрий функционировать как самостоятельно, так и в качестве биохимических машин и как часть обширной, чувствительной сети.

Морфология и функция митохондриальной сети определяются регулируемым балансом между делением и слиянием. Деление митохондрий требуется для наследования дочерних клеток митохондрий при делении клеток [28], а также для селективной аутофагической деградации деполяризованных или поврежденных митохондрий, называемой митофагией [1]. И наоборот, для комплементации митохондриальных геномов и совместного использования компонентов электронной транспортной цепи между соседними митохондриями требуется синтез [54]. На молекулярном уровне деление и слияние митохондрий регулируются крупными динаминоподобными ГТФазами. Три фермента в основном регулируют слияние: Mitofusins ​​1 и 2 (Mfn1 / 2) представляют собой двухсторонние наружные мембранные белки, которые опосредуют синтез наружных мембран через гетеротипические взаимодействия между соседними митохондриями [15], [25], [37], тогда как OPA1 является внутренним мембранный белок, который одновременно обеспечивает матричную связность путем регулирования слияния внутренних мембран [5]. Активность GTPазы всех трех белков необходима для надежного слияния [5], [18] и OPA1 далее регулируется сложным протеолизом внутри внутренней мембраны митохондрий протеазами OMA1 [14], PARL [6] и YME1L [45 ]. Важно отметить, что для эффективного слияния необходим цельный митохондриальный мембранный потенциал для подавления интеграции поврежденных и здоровых митохондрий [26].

Деление митохондрий в первую очередь катализируется цитозольным белком, называемым динамин-родственным белком 1 (Drp1 / DNM1L). Drp1 завербовывается из цитозоля в предполагаемые участки деления на наружную мембрану митохондрий [43]. Основными рецепторами Drp1 на внешней мембране являются фактор деления митохондрий (Mff) [32] и, в меньшей степени, Fission 1 (Fis1) [51]. Кроме того, был обнаружен приемник-приемник MIEF1 / MiD51, который действует для дальнейшего ограничения активности белка Drp1 на потенциальных сайтах деления [58]. После присоединения к наружной мембране митохондрий Drp1 олигомеризуется в спиральные структуры вокруг тела митохондрии, а затем использует энергию, полученную из гидролиза GTP, чтобы опосредовать физическое расщепление наружных и внутренних мембран митохондрий [17]. Трубры, полученные из эндоплазматического ретикулума, выступают в качестве исходного констриктора митохондрий до олигомеризации Drp1, подчеркивая откровение, что неконстрицированные митохондрии шире, чем разрешающая окружность завершенной спирали Drp1 [12]. Динамика актина также важна для взаимодействий ER-митохондрий, предшествующих делению митохондрий [24]. В дополнение к своей роли в делении митохондрий Drp1 катализирует деление пероксисом [40].

Drp1 очень похож на хорошо охарактеризованный динаминовый белок, поскольку оба белка содержат N-концевой домен GTPase, средний домен, который является критическим для самоолигомеризации, и C-концевой эффекторный домен GTPase [31]. Drp1 достигает селективности для митохондриальных мембран посредством сочетания взаимодействий с его рецепторными белками Mff и Fis1, а также благодаря его сродству к митохондриальному фосфолипидному кардиолипину через уникальный домен B-insert Drp1 [2]. Drp1 обычно существует как гомотетрамер в цитоплазме, а сборка более высокого порядка на сайтах деления митохондрий опосредуется средним доменом Drp1 [3].

Учитывая неявную связь между митохондриальной функцией и пути KEAP1-Nrf2-ARE, мы исследовали эффекты активации Nrf2 на структуру и функцию митохондрий. Мы демонстрируем здесь, что SFN индуцирует митохондриальную гиперфузию, которая неожиданно не зависит ни от Nrf2, ни от KEAP1. Этот эффект SFN происходит за счет ингибирования функции Drp1. Мы также продемонстрируем, что SFN обеспечивает устойчивость к апоптозу, который независим от Nrf2 и имитирует, что наблюдается в клетках, обедненных Drp1. Эти данные в совокупности указывают на то, что в дополнение к стабилизации и активации Nrf2 SFN модулирует митохондриальную динамику и сохраняет клеточную пригодность и выживаемость.

Результаты

Сульфорафан индуцирует Nrf2 / KEAP1-независимую гиперфункцию Mitochondria

В ходе изучения влияния активации Nrf2 на динамику митохондриальной сети мы обнаружили, что обработка иммортализованных эпителиальных клеток эпителия (РПЭ-1) человека с сульфорафаном (SFN), мощным активатором передачи сигналов Nrf2, вызвала надежное слияние митохондриальной сети по сравнению с контрольными клетками, обработанными транспортным средством (рис. 1A и B). Морфология митохондрий в этих клетках очень напоминала митохондрии в клетках, истощенных сиРНК эндогенного Drp1, основного фактора деления митохондрий (рис. 1A). Этот результат поднял интригующую идею о том, что состояние деления и слияния митохондрий отвечает непосредственно уровням Nrf2 в клетке. Однако стимуляция клеток другими стабилизаторами и активаторами Nrf2, такими как ингибитор протеасомы MG132, прооксидантный tBHQ или нокдаун ингибитора Nrf2 KEAP1, не индуцирует митохондриальный синтез (рис. 1A и B). Стабилизация Nrf2 этими манипуляциями была подтверждена вестерн-блоттингом для эндогенного Nrf2 (фиг. 1C). Кроме того, экспрессия Nrf2 была бесплатной для SFN-индуцированного митохондриального слияния, поскольку нокдаун эндогенного Nrf2 с siRNA не смог противостоять этому фенотипу (рис. 1D-F). Поскольку SFN стимулирует путь KEAP1-Nrf2-ARE путем ковалентной модификации остатков цистеина KEAP1 [21], мы сбили KEAP1, чтобы определить, стимулируется ли SFN-индуцированная митохондриальная гиперфузия через зависимый от KEAP1, но Nrf2 независимый путь. Однако истощение KEAP1 также не позволило аннулировать синтез митохондрий, индуцированный SFN (рис. 1G-I). Фактически, SFN отменил морфологию проделения, вызванную истощением KEAP1 (рис. 1G, панель b и панель d). Эти результаты показывают, что лечение SFN вызывает митохондриальное слияние, не зависящее от канонического пути KEAP1-Nrf2-ARE, и привело нас к тому, чтобы допросить, влияет ли SFN на компоненты механизма деления или синтеза митохондрий.

Рисунок 1 SFN индуцирует Nrf2 / KEAP1-независимый митохондриальный синтез. (A) клетки RPE-1 трансфицировали указанными siRNAs, а 3-дни обрабатывали DMSO или Nrf2-активаторами SFN (50 мкМ), MG132 (10 мкМ) или tBHQ (100 мкМ) для 4 h. Митохондрии (красный) помечены антителом против Tom20, а ядра (синий) контрастируют с DAPI. (B) График, показывающий количественную оценку морфологии митохондрий из (A). > Ячейки 50 на состояние оценивались вслепую. (C) Представительные вестерн-блоты из (A). (D) Клетки RPE-1 трансфицировали с помощью 10 nM siRNA и 3 дней, обработанных SFN для 4 h до фиксации и окрашивания, как в (A). (E) График, показывающий количественную оценку затухания фенотипа митохондрий из (D). > Ячейки 100 на состояние оценивались вслепую. (F) Представительские вестерн-блоты из (D). (G) Клетки трансфицировали и обрабатывали, как в (D), с помощью siCON или siKEAP1. (H) Клетки из (G) оценивали как в (B) и (E) на основе морфологии митохондрий. (I) Представительские вестерн-блоты из (G). Данные в (B), (E) и (H) составлялись из независимых экспериментов 3, а статистическая значимость определялась с помощью двухстороннего t-теста Стьюдента. Шкалы ошибок отражают +/- SD (для интерпретации ссылок на цвет в этой легенде фигуры читатель ссылается на веб-версию этой статьи).

Сульфорафан ослабляет ассоциацию митохондрий Drp1

Основываясь на обнаружении того, что обработка SFN вызывает митохондриальную гиперфузию, мы предположили, что этот фенотип является следствием чрезмерной активности слияния или ингибирования активности деления. Чтобы различать эти две возможности, мы сравнили морфологию пероксисом в присутствии и отсутствии SFN. Пероксисомы похожи на митохондрии, поскольку они являются динамическими органеллами, форма и длина которых постоянно находятся в потоке [44]. Пероксисомы содержат как Fis1, так и Mff в их наружной мембране и, как следствие, являются мишенями для опосредованного Drp1 деления [22], [23]. Однако пероксисомы не используют механизм слияния митохондриальной сети и, следовательно, не подвергаются слиянию [39]. Скорее, пероксисомальное деление противопоставлено удлинением существующих пероксисом путем добавления новых мембран и белков [44]. Поскольку пероксисом не хватает Mfn1 / 2 и OPA1, мы предположили, что если SFN активирует аппаратуру слияния, а не ингибирует механизм деления, длина пероксисома не будет затронута. В клетках, обработанных транспортным средством, пероксисом поддерживают как короткие, округлые, пунктирные органеллы (рис. 2, панели b и d). Однако обработка SFN увеличивала длину пероксисом на ~ 2-fold по сравнению с контрольными клетками (рис. 2, панели f и h). Кроме того, многие из пероксисом были зажаты вблизи центра, что указывает на потенциальный дефект распада (рис. 2, панель h, наконечники стрел). Аналогично, пероксисомы в клетках, трансфекцированных с помощью siRNA Drp1, были аномально длинными (рис. 2, панели j и l), подтверждая, что Drp1 необходим для пероксисомального деления и предполагает, что SFN-обработка вызывает митохондриальные и пероксисомальные фенотипы, разрушая механизм деления.

Рисунок 2 SFN индуцирует пероксисомальное удлинение. (A) Клетки RPE-1 трансфицировали с помощью 10 nM указанной siRNA и 3 дней, обработанных DMSO или 50 мкМ SFN для 4 h. Пероксисомы (зеленые) были помечены антителом против PMP70, митохондриями с MitoTracker (красный) и ДНК, контрастируемая с DAPI. Расширенные вставки пероксисом показаны справа (панели d, h и l), чтобы облегчить визуализацию изменений в морфологии, вызванных SFN и истощением Drp1. Стрелки указывают точки сужения. (Для интерпретации ссылок на цвет в этой фигуре легенда читатель ссылается на веб-версию этой статьи).

Затем мы определили, как SFN ограничивает функцию Drp1. Возможности включали снижение уровней экспрессии, рекрутирование / удержание митохондрий, олигомеризацию или ферментативную активность ГТФазы. Дефицит в любом из них приведет к уменьшению деления и гипертонии митохондрий. Мы не обнаружили воспроизводимых изменений уровней белка Drp1 после обработки SFN (фиг. 1C и 3A), и поэтому пришел к выводу, что SFN не изменяет стабильность или выражение Drp1 в соответствии с Drp1, имеющим период полураспада> 10 h [50], и наши методы SFN имеют более короткую продолжительность. Затем мы исследовали, повлияло ли SFN на вербовку или сохранение Drp1 в митохондрии. Исследования фракционирования показали, что SFN индуцирует потерю Drp1 из фракции митохондрий (рис. 3A, полосы 7-8 и рис. 3B). Как сообщалось ранее [43], только незначительная доля Drp1 (~ 3%) связана с митохондриальной сетью в любой момент времени в течение устойчивое состояние условия с большей частью фермента, находящегося в цитоплазме (рис. 3A, полосы 5-8). Эти данные фракционирования были подтверждены с использованием совместного анализа локализации, который показал уменьшение 40% в локализованных митохондриях, пунктированных фокусах Drp1 после обработки SFN (рис. 3C и D). Вместе эти данные показывают, что синтез митохондрий, индуцированный SFN, по меньшей мере частично обусловлен ослабленной ассоциацией Drp1 с митохондриями. В наших данных не проводится различие между тем, влияет ли SFN на митохондриальный рекрутинг против митохондриального удержания Drp1 или обоих, поскольку анализ эндогенного Drp1 не поддается визуализации GTPase с помощью жидкостной клеточной микроскопии.

Рисунок 3 SFN вызывает потерю Drp1 из митохондрий. (A) Субклеточное фракционирование клеток RPE-1 после 4 h ДМСО или SFN. Цельноклеточные лизаты (WCL), ядерные (Nuc), цитозольные (Cyto) и сырые митохондриальные (Mito) фракции разрешались SDS-PAGE и обрабатывались для вестерн-блоттинга с указанными антителами. Миграция маркеров молекулярного веса показана слева. (B) Графики, показывающие денситометрическую количественную оценку Drp1 в указанных фракциях из (A). (C) Клетки RPE-1 трансфицировали 10 nM siCON или siDrp1 и 3 дней спустя, обработанных DMSO или SFN для 4 h. Drp1 (зеленый) визуализировали антителом против Drp1, митохондриями с MitoTracker (красный) и ядрами DAPI (синий). (D) Автоматический анализ совместной локализации сигналов Drp1 и MitoTracker от (C). Данные в (B) и (D) были составлены из независимых экспериментов 3 и 5 соответственно, а статистическая значимость была определена с помощью двухстороннего t-теста Стьюдента. Шкалы ошибок отражают +/- SD, а звездочки обозначают статистическую значимость. (Для интерпретации ссылок на цвет в этой фигуре легенда читатель ссылается на веб-версию этой статьи).

Сульфорафан защищает от апоптоза, индуцированного Staurosportine, независимо от Nrf2

Предыдущая работа показала, что деление митохондрий является разрешительным при образовании пор во внешней митохондриальной мембране, продуцируемой Bax / Bak во время апоптоза [11]. Было показано, что Drp1 избирательно рекрутируется в митохондрии во время апоптоза [11], и, в соответствии с этим, фрагментированные митохондрии наблюдаются на ранней стадии процесса [27]. И наоборот, ингибирование деления митохондрий, как полагают, ингибирует апоптоз, блокируя образование поры внешней мембраны, которые позволяют выделять цитохром c [53]. Соответственно, стимулирование митохондриального синтеза задерживает прогрессирование апоптоза, индуцированного соединениями, включая стауроспорин (STS) [14]. Чтобы определить, защищает ли SFN клетки RPE-1 от опосредованного STS апоптоза, и если да, то для этого требуется Nrf2, мы установили анализ, чтобы легко индуцировать расщепление поли ADP рибозной полимеразы (PARP), субстрат активированной каспазы-3 и окончательный маркер апоптоза. Обработка клеток RPE-1 с помощью 1 μM STS для 6 h вызывала очень скромное расщепление PARP, но это предотвращалось со-обработкой SFN (например, на рисунке 4A, полоса 3 и 4). Чтобы повысить устойчивость этого анализа, мы дополнительно сенсибилизировали клетки к апоптозу, вызванному STS, предварительно обработав их с помощью сиРНК, нацеленной на антиапоптотический фактор Bcl-XL. Эта предварительная обработка уменьшала экспрессию Bcl-XL и заметно повышала расщепление PARP как функцию времени, подвергаемого STS (рис. 4B, сравнивают полосу 2 с полосами 4-10). Важно отметить, что 2 h предварительной обработки SFN уменьшает расщепление PARP в клетках, подвергшихся воздействию STS (фиг. 4C, полоса 3 против 4 и полоса 5 по сравнению с 6). Аналогично, клетки, стабильно обедненные Nrf2 CRISPR / Cas9, были сравнительно защищены от STS-токсичности с помощью предварительной обработки SFN (фиг. 4C, полоса 11 по сравнению с 12 и полосой 13 по сравнению с 14 и фиг. 4D). Эта защита наблюдалась с использованием расщепления PARP (рис. 4C и D) и клеточной морфологии (рис. 4E) в качестве показаний. Эффективность истощения Nrf2 CRISPR / Cas9 была подтверждена вестерн-блоттингом (фиг. 4C, Nrf2-блот). Как и было предсказано, истощающие клетки Drp1, которые также дают фенотип гиперфузии (рис. 1A), также блокировали расщепление PARP в ответ на STS по сравнению с контрольными клетками, инкубированными с SFN (рис. 4F и G). Вместе эти результаты согласуются с SFN, обеспечивающим защиту от апоптоза благодаря способности ограничивать функцию Drp1, независимо от стабилизации и активации Nrf2.

Рисунок 4. Цитопротективное действие SFN не зависит от экспрессии Nrf2 (A). Клетки RPE-1 предварительно обрабатывали DMSO или 50 мкМ SFN для 2 h перед обработкой DMSO, 1 мкМ staurosporine (STS) или 50 μM этопозидом для 6 h и были обработаны для анти-PARP-вестерн-блоттинга. (B) Клетки RPE-1 трансфицировали 2.5 nM siCON, 1 nM siBcl-XL или 2.5 nM siBcl-XL и 3 дней спустя обрабатывали DMSO или 1 μM STS для 2, 4 или 6 h. Показаны представительные вестерн-блоты и показана миграция маркеров молекулярной массы слева. (C) CRISPR / Cas9-порожденные клетки NNFXNWX и Nrf2 (Nrf2KO) RPE-2 были трансфицированы 1 nM siBcl-XL и спустя 1 были предварительно обработаны DMSO или 3 мкМ SFN для 50 h. Затем клетки обрабатывали 2 μM STS для 1, 2 или 4 h. Показаны представительные вестерн-блоты с указанными антителами. (D) Количественное определение расщепленного PARP в процентах от общего PARP (расщепленного + нерасщепленного) из независимых экспериментов 6. Важно отметить, что уровни расщепленного PARP были сопоставимы, если клетки выражены Nrf3 или нет, что указывает на то, что защита SFN от STS не зависит от фактора транскрипции. (E) 2X фазово-контрастные изображения, снятые непосредственно перед сборкой лизатов из (C). Шкала шкалы = 20 мкм. (F) Представительные вестерн-блоты, демонстрирующие, что истощение Drp65 обеспечивает почти сравнимую защиту от STS как лечение SFN. Клетки RPE-1 трансфицировали 1 nM siBcl-XL и дополнительно трансфицировали либо 1 nM siCON, либо 10 nM siDrp10. Через 1 дней клетки siCON предварительно обрабатывали SFN, как в (A) и (C), а затем подвергали воздействию STS для 3 h перед тем, как их собирали и обрабатывали для вестерн-блоттинга с указанными антителами. (G) То же, что и (D) для данных, представленных в (F), составленных из независимых экспериментов 4. Шкалы ошибок отражают +/- SEM

Обсуждение

Мы обнаружили, что SFN модулирует динамику деления / слияния митохондрий независимо от ее влияния на путь KEAP1-Nrf2-ARE. Это интригует из-за предполагаемой связи между митохондриальной дисфункцией и продукцией ROS и необходимостью измельчения свободных радикалов, полученных из митохондрий, посредством активации Nrf2. Это дополнительное функциональное воздействие SFN имеет потенциальное значение, учитывая более чем клинические испытания 30, которые в настоящее время проходят тестирование SFN для лечения различных заболеваний, включая рак предстательной железы, обструктивную болезнь легких и серповидноклеточную болезнь [7], [10], [ 47].

Поскольку SFN представляет собой изотиоцианат [56], и он активирует передачу Nrf2 путем прямого ацилирования критических цистеинов KEAP1 для подавления деградации Nrf2 [21], следует, что SFN оказывает свои эффекты про-слития путем модуляции активности фактора деления или слияния посредством модификации цистеина , Наши данные сильно поддерживают Drp1, которые отрицательно регулируются SFN, хотя необходимо выяснить, является ли GTPase прямой мишенью ацилирования. Несмотря на этот пробел в знаниях, функция Drp1 явно скомпрометирована SFN, поскольку и митохондрии, и пероксисомы становятся hyperfused в ответ на обработку SFN, и эти органеллы делят Drp1 на их соответствующие события распада [38]. Кроме того, SFN уменьшает количество Drp1, которое локализуется и накапливается в митохондриях (рис. 3). Поскольку наши эксперименты проводились со всеми эндогенными белками, наше обнаружение Drp1 на участках митохондриального деления находится в стационарных условиях, и, следовательно, мы не можем отличить рекрутинг от дефекта удерживания фермента, вызванного SFN. Кроме того, мы не можем исключить возможность того, что SFN ацилирует рецептор в митохондриях (Fis1 или Mff) для блокирования набора Drp1, однако мы подозреваем, что Drp1 непосредственно модифицирован. Drp1 имеет девять цистеинов, восемь из которых находятся в пределах среднего домена, который требуется для олигомеризации [3], и один из них находится в домене эффектора GTPase (GED) на C-конце Drp1. Прямое ацилирование любого из этих цистеинов может вызвать дефект активности в Drp1 и, следовательно, лежит в основе влияния SFN на митохондриальную динамику. Примечательно, что предыдущая работа предполагает, что дефекты олигомеризации и каталитической активности могут аннулировать сохранение Drp1 в митохондриях [52]. Cys644 в домене GED является особенно привлекательной целью, основанной на предыдущей работе, показывающей, что мутация этих цистеиновых феноксисов мутаций, которые нарушают активность Drp1 GTPase [4], и что этот конкретный цистеин модифицируется тио-реактивными электрофилами [9]. Разрешение этого нерешенного вопроса потребует масс-спектрометрической валидации Резюме, мы идентифицировали новую цитопротекторную функцию для клинически значимого соединения SFN. В дополнение к активации основного антиоксидантного фактора транскрипции Nrf2, SFN способствует митохондриальному и пероксисомальному слиянию, и этот эффект не зависит от Nrf2. Механизм, лежащий в основе этого явления, связан с уменьшением функции GTPase Drp1, основного медиатора митохондриального и пероксисомального деления. Основным следствием SFN-опосредованного митохондриального слияния является то, что клетки становятся устойчивыми к токсическим эффектам апоптоза индуцирующего ставроспорина. Это дополнительное цитопротективное действие SFN может быть особенно полезным в многочисленных нейродегенеративных заболеваниях, для которых возраст является ведущим фактором риска (например, болезнь Паркинсона, болезнь Альцгеймера, возрастная дегенерация желтого пятна), поскольку эти заболевания связаны с апоптозом и снижены уровней и / или дисрегуляции Nrf2 [35], [36], [48]. Вместе эти данные показывают, что цитопротективные свойства SFN выходят за рамки активации системы KEAP1-Nrf2-ARE и требуют дальнейших исследований, учитывая текущее использование этого агента в нескольких клинических испытаниях.

Материалы и Мethods

Анализы апоптоза

Клетки высевали и трансфицировали siRNA, как указано ниже. Клетки предварительно обработали 50 мкМ сульфофафеном для 2 h для индуцирования митохондриального слияния и затем обрабатывали стауроспорином 1 мкМ для индукции апоптоза. Во время сбора урожая среды собирали в отдельных пробирках и подвергали высокоскоростному центрифугированию в апоптотические клетки гранул. Этот клеточный осадок объединяли с адгезивными клетками и солюбилизировали в 2-концентрированном лаэмми-буфере. Образцы подвергали анти-PARP-вестерн-блоттингу.

Создание CRISPR / Cas9 Construct

Чтобы создать LentiCRISPR / eCas9 1.1, LentiCRISPR v2 (addgene #52961) был сначала разрезан Age1 и BamH1. Затем SpCas9 из eSpCas9 1.1 (addgene #71814) был амплифицирован PCR с помощью выступов Age1 и BamH1 с использованием следующих праймеров (Forward AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTCTCTTTTTGGCCTGGCCGG) и лигировали в вектор разреза выше. Последовательности sgRNA определяли с использованием Benchling.com. Параметры были настроены так, чтобы нацеливать кодирующую последовательность с наивысшими показателями на целевом и низком уровне вне цели. Следующие последовательности (направл юща последовательность подчеркнуты, HS sgNFE2L2 # 1 чувство CACCGCGACGGAAAGAGTATGAGC, антисмысловую AAACGCTCATACTCTTTCCGTCGC; HS sgNFE2L2 # 2 чувство CACCGGTTTCTGACTGGATGTGCT, антисмысловой AAACAGCACATCCAGTCAGAAACC; вс sgNFE2L2 # 3 смысл CACCGGAGTAGTTGGCAGATCCAC, антисмысловой AAACGTGGATCTGCCAACTACTCC) отжигали и лигировали в BsmB1 вырезать LentiCRISPR / eCas9 1.1. Лентивирально инфицированные клетки RPE-1 были выбраны с пуромицином и поддерживались в виде объединенной популяции. Нокаут был подтвержден иммунофлюоресценцией и вестерн-блоттингом.

Культура клеток и трансфекции

Эпителиальные клетки ретинального пигмента человека, трансформированные теломеразой (RPE-1) (АТСС), культивировали в модифицированной среде Dulbecco Modified Eagle Medium (DMEM), содержащей глюкозу 1 г / л, дополненную пенициллином, стрептомицином, незаменимым аминокислотным коктейлем 1X (Life Technologies), и 10% фетальной бычьей сыворотки (Life Technologies). Для siRNA-трансфекций клетки 30,000-35,000 / мл высевали в течение ночи. Клетки получили 10 nM siRNA, разведенные в бессывороточной DMEM и объединенные с 0.3% Interferin transfection reagent (PolyPlus). Для сенсибилизации апоптоза клетки получали 1 nM Bcl-XL siRNA. Клетки собирали 2-3 дней после трансфекции.

Химические вещества, антитела и сиРНК-олиго

Антитела против α-тубулина (клеточная сигнализация), β-тубулин (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signaling), PMP70 (Abcam) и Tom20 (BD Biosciences ) использовали в растворах 1: 1000 для вестерн-блоттинга и для иммунофлюоресценции. Внутреннее антитело кролика-анти-Nrf2 использовали в 1: 2000 для вестерн-блоттинга [34], [59]. Сульфорафан (Sigma) и стауроспорин (Tocris) использовали в 50 мкМ и 1 мкМ соответственно. siRNAs против Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signaling) и Bcl-XL (Cell Signaling) использовались в 10 nM, если не указано иное.

Иммунофлуоресценция и маркировка Vivo

Клетки, высеваемые на стеклянных покровных стеклах 18 мм, обрабатывали носителем или лекарственным средством, фиксировали в 3.7% формальдегиде, а затем пермеабилизировали в 0.2% Triton X-100 / PBS на льду для 10 мин. Первичные антитела инкубировали в 3% бычьего сывороточного альбумина (BSA) в PBS в течение ночи при 4 ° C. После промывки PBS клетки инкубировали для 1 h в соответствующих видах, Alexa488- или Alexa546-, конъюгированных вторичных антителах (разбавленных 1: 1000) и 0.1 мкг / мл DAPI (Sigma) в 3% BSA / PBS. Митохондрии визуализировали либо путем иммунофлюоресценции против Tom20, либо путем инкубации клеток в 200 nM MitoTracker Red CMXRos (Molecular Probes, Inc.) в бессывороточной DMEM для 30 мин при 37 ° C до фиксации.

Микроскопия и анализ изображений

Образцы иммунофлюоресценции просматривали на конфокальном микроскопе LSM710 (Carl Zeiss). Микрофотографии были захвачены с использованием объектов 63X или 100X для иммерсии масла, а изображения были отрегулированы и расширены с использованием Adobe Photoshop CS6. Анализ Co-локализации проводился с использованием функции Co-локализации Carl Zeiss LSM710 с пороговыми значениями, установленными вручную, в то время как слепые к идентичности образцов. Масштабирование на всех уровнях, если не указано иное, составляет 10 мкм. Морфологию митохондрий оценивали по ослепленному результату. Если митохондрии клетки поддерживались как множественные, круглые, различающиеся пункции, клетка была забита как «деление». Если отдельные митохондрии были неразличимы, и вся митохондриальная сеть стала непрерывной, клетка была оценена как «слияние». Все остальные клетки, в том числе с кластеризацией митохондрий, оценивались как «промежуточные».

Субклеточные фракции

Клетки RPE-1 выращивали до слияния. После промывки PBS клетки подвергали центрифугированию при 600 × g для 10 мин и ресуспендировали в изолирующем буфере 600 μL (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 мМ EDTA pH 7.4 + 1 мМ PMSF). Суспензию лизировали 30 раз в гомогенизаторе Dounce. Часть гомогената была сохранена как «цельный клеточный лизат». Остальную часть подвергали центрифугированию при 800 × g для 10 мин для осаждения ядер. Супернатанты подвергали центрифугированию при 1500 × g для 10 мин, чтобы очистить оставшиеся ядра и нелизированные клетки. Этот супернатант подвергали центрифугированию при 15,000 × g для 15 min до образования гранул митохондрий. Супернатант сохраняли как «цитозольную фракцию». Осадок осторожно промывали PBS и ресуспендировали в изолирующем буфере. Концентрацию белка каждой фракции измеряли с помощью анализа бицинхониновой кислоты (BCA) и эквивалентные количества белка разрешали с помощью SDS-PAGE.

Вестерн-блоттинг

Клетки промывали в PBS и солюбилизировали в 2 раз концентрированном солюбилизирующем буфере Laemmli (100 mM Tris [pH 6.8], 2% SDS, 0.008% бромфенол синий, 2% 2-меркаптоэтанол, 26.3% глицерин и 0.001% Pyrinin Y). Лизаты кипятили в течение 5 мин перед загрузкой на полиакриламидные гели додецилсульфата натрия (SDS). Белки переносили в нитроцеллюлозные мембраны и мембраны блокировали для 1 h в 5% Milk / TBST. Первичные антитела разводили в 5% Milk / TBST и инкубировали с блотсом в течение ночи при 4 ° C. Сосудистые пероксидазы хрена (HRP) -конъюгированные вторичные антитела разводились в 5% Milk / TBST. Блоты обрабатывали с улучшенной хемилюминесценцией, а денситометрические количественные измерения выполняли с использованием программного обеспечения ImageJ.

Д-р Хименес Белое пальто

Сульфорафан представляет собой химическое вещество из изотиоцианатного сбора органосульфовых веществ, полученных из крестоцветных овощей, в том числе брокколи, капусты, цветной капусты, капусты и капусты. Сульфорафан образуется, когда фермент мирозиназа превращает глюкорафанин, глюкозинолат, в сульфорафан, также известный как сульфорафан-глюкозинолат. Проростки брокколи и цветная капуста имеют самую высокую концентрацию глюкорафанина или предшественника сульфорафана. Исследования показали, что сульфорафан усиливает антиоксидантные свойства организма человека для предотвращения различных проблем со здоровьем.

Д-р Алекс Хименес, DC, CCST Insight

Сульфорафан и его влияние на рак, смертность, старение, мозг и поведение, сердечные заболевания и многое другое

Изотиоцианаты являются одними из самых важных соединений растений, которые вы можете получить в своем рационе. В этом видео Я делаю наиболее полный случай для них, которые когда-либо были сделаны. Краткий охват внимания? Перейдите в свою любимую тему, нажав на один из пунктов ниже. В полностью график ниже.

Основные разделы:

  • 00: 01: 14 - Рак и смертность
  • 00: 19: 04 - Старение
  • 00: 26: 30 - Мозг и поведение
  • 00: 38: 06 - окончательное резюме
  • 00: 40: 27 - Доза

Полная временная шкала:

  • 00: 00: 34 - Введение сульфорафана, основной фокус видео.
  • 00: 01: 14 - потребление крестоцветных овощей и снижение смертности от всех причин.
  • 00: 02: 12 - Риск рака предстательной железы.
  • 00: 02: 23 - Риск рака мочевого пузыря.
  • 00: 02: 34 - Рак легких у курильщиков.
  • 00: 02: 48 - Риск рака молочной железы.
  • 00: 03: 13 - Гипотетический: что, если у вас уже есть рак? (Интервенционный)
  • 00: 03: 35 - правдоподобный механизм вождения рак и ассоциативные данные о смертности.
  • 00: 04: 38 - Сульфорафан и рак.
  • 00: 05: 32 - свидетельства о животных сильный влияние экстракта проростков брокколи на развитие опухоли мочевого пузыря у крыс.
  • 00: 06: 06 - Влияние прямого дополнения сульфорафана у пациентов с раком предстательной железы.
  • 00: 07: 09 - Биоаккумуляция метаболитов изотиоцианата в реальной ткани молочной железы.
  • 00: 08: 32 - Ингибирование стволовых клеток рака молочной железы.
  • 00: 08: 53 - Урок истории: бразики были установлены как имеющие свойства здоровья даже в Древнем Риме.
  • 00: 09: 16 - способность сульфорафана усилить экскрецию канцерогенов (бензол, акролеин).
  • 00: 09: 51 - NRF2 в качестве генетического переключателя через элементы антиоксидантного ответа.
  • 00: 10: 10. Как активация NRF2 усиливает экспрессию канцерогена через глютатион-S-конъюгаты.
  • 00: 10: 34 - Брюссельская капуста увеличивает глутатион-S-трансферазу и уменьшает повреждение ДНК.
  • 00: 11: 20 - Проростковый напиток из брокколи увеличивает экскрецию бензола 61%.
  • 00: 13: 31 - гомогенат проростков брокколи увеличивает антиоксидантные ферменты в верхних дыхательных путях.
  • 00: 15: 45 - Распространение крестоцветных овощей и смертность от сердечно-сосудистых заболеваний.
  • 00: 16: 55 - порошок проростков брокколи повышает уровень липидов в крови и общий риск сердечных заболеваний у диабетиков типа 2.
  • 00: 19: 04 - Начало старение раздел.
  • 00: 19: 21 - обогащенная сульфорафаном диета улучшает продолжительность жизни жуков от 15 до 30% (в определенных условиях).
  • 00: 20: 34 - Важность низкого воспаления для долголетия.
  • 00: 22: 05 - Крестоцветные овощи и порошок проростков брокколи, по-видимому, уменьшают большое количество воспалительных маркеров у людей.
  • 00: 23: 40 - Среднее видео: рак, старение
  • 00: 24: 14 - Исследования мышц предполагают, что сульфорафан может улучшить адаптивную иммунную функцию в пожилом возрасте.
  • 00: 25: 18 - Сульфорафан улучшил рост волос в мышиной модели облысения. Картина в 00: 26: 10.
  • 00: 26: 30 - Начало раздела мозга и поведения.
  • 00: 27: 18 - Влияние экстракта экстракта брокколи на аутизм.
  • 00: 27: 48 - Влияние глюкорафанина на шизофрению.
  • 00: 28: 17 - начало обсуждения депрессии (правдоподобный механизм и исследования).
  • 00: 31: 21. Исследование мыши с использованием 10 различных моделей стресс-индуцированной депрессии показывает сульфорафан, аналогично эффективный как флуоксетин (Прозак).
  • 00: 32: 00 - Исследование показывает, что прямой прием глюкорафанина у мышей также эффективен при предотвращении депрессии из модели стресса социального поражения.
  • 00: 33: 01 - начало раздела нейродегенерации.
  • 00: 33: 30 - Сульфорафан и болезнь Альцгеймера.
  • 00: 33: 44 - болезнь Сульфорафана и Паркинсона.
  • 00: 33: 51 - Сульфорафан и болезнь Хунттонтона.
  • 00: 34: 13 - Сульфорафан увеличивает белки теплового шока.
  • 00: 34: 43 - Начало черепно-мозговой травмы.
  • 00: 35: 01 - Сульфорафан вводится сразу же после того, как TBI улучшает память (исследование мыши).
  • 00: 35: 55 - Сульфорафан и нейронная пластичность.
  • 00: 36: 32 - Сульфорафан улучшает обучение в модель диабета типа II у мышей.
  • 00: 37: 19 - Сульфорафан и Дюшенна мышечная дистрофия.
  • 00: 37: 44 - ингибирование миостатина в мышечных сателлитных клетках (in vitro).
  • 00: 38: 06 - краткое изложение: смертность и рак, повреждение ДНК, окислительный стресс и воспаление, экскреция бензола, сердечно-сосудистые заболевания, диабет II типа, воздействие на мозг (депрессия, аутизм, шизофрения, нейродегенерация), путь NRF2.
  • 00: 40: 27 - Мысли о вычислении дозы проростков брокколи или сульфорафана.
  • 00: 41: 01 - Анекдоты о прорастании дома.
  • 00: 43: 14 - О температуре приготовления и активности сульфорафана.
  • 00: 43: 45 - Конверсия бактерий кишечника из сульфорафана из глюкорафанина.
  • 00: 44: 24 - Дополнения улучшаются в сочетании с активной мирозиназой из овощей.
  • 00: 44: 56 - Техника приготовления и крестоцветные овощи.
  • 00: 46: 06 - изотиоцианаты в виде зотрогенов.

Благодарности

Sciencedirect.com/science/article/pii/S2213231716302750

Как производится Сульфорафан?

Нагревание уменьшает активность протеинов Epithiospecifier и увеличивает образование сульфорафанов в брокколи

Абстрактные

Сульфорафан, изотиоцианат из брокколи, является одним из наиболее мощных пищевых антиканцерогенов. Это соединение отсутствует в нетронутом овоще, скорее оно образовано из его предшественника глюкозинолата, глюкорафанина, действием мирозиназы, фермента тиоглюкозидазы, когда ткань брокколи измельчается или жевали. Тем не менее, ряд исследований показал, что выход сульфорафана из глюкорафанина низкий, и что небиоактивный нитрильный аналог, сульфорафан нитрил, является основным продуктом гидролиза, когда растительная ткань измельчается при комнатной температуре. Недавние данные свидетельствуют о том, что в Arabidopsis образование нитрила из глюкозинолатов контролируется теплочувствительным белком, epithiospecifier белок (ESP), некаталитический кофактор мирозиназы. Наши цели состояли в том, чтобы изучить влияние нагревания цветков брокколи и ростков на образование сульфорафана и сульфорафана нитрила, чтобы определить, содержит ли брокколи активную активность ESP, затем коррелировать зависящие от тепла изменения активности ESP, содержание сульфорафана и биоактивность, измеряемые индукцией фазе II детоксикации фермента хинон редуктазы (QR) в культуре клеток. Нагревание свежих брокколи или ростков брокколи до 60 ° C до гомогенизации одновременно увеличивало образование сульфорафанов и уменьшало образование сульфорафан-нитрила. Значительная потеря активности ESP параллельна уменьшению образования сульфорафан-нитрила. Нагрев до 70 ° C и выше уменьшал образование обоих продуктов в цветочках брокколи, но не в ростках брокколи. Индукция QR в клетках культивируемой мышиной гепатомы Hepa lclc7 параллельна увеличению образования сульфорафанов.

Предварительные нагревания брокколи и ростки до 60 ° C значительно увеличивали катализируемое мирозиназой образование сульфорафана (SF) в экстрактах растительных тканей после дробления. Это было связано с уменьшением образования сульфорафан нитрила (SF нитрила) и активности протеина эпитиоспецификатора (ESP).

Ключевые слова: Брокколи, Brassica oleracea, Cruciferae, Рак, Антикарциноген, Сульфорафан, Сульфорафан нитрил, Эпитиоспецифический белок, Хинон редуктаза

В заключение, сульфорафан является фитохимическим, обнаруженным в брокколи,и другие крестоцветные овощи. Неконтролируемое количество окислителей, вызванное как внутренними, так и внешними факторами, может вызвать окислительный стресс в организме человека, что в конечном итоге может привести к различным проблемам со здоровьем. Сульфорафан может активировать продукцию Nrf2, транскрипционного фактора, который помогает регулировать защитные антиоксидантные механизмы, которые контролируют реакцию клетки на окислители. Объем нашей информации ограничен вопросами хиропрактики и позвоночника. Чтобы обсудить этот вопрос, пожалуйста, обращайтесь к доктору Хименесу или свяжитесь с нами по телефону 915-850-0900 .

Куратор д-р Алекс Хименес

Ссылка из: Sciencedirect.com

Кнопка «Зеленый звонок» H .png

Дополнительная тема Обсуждение: Острая боль в спине

Боль в спине является одной из наиболее распространенных причин инвалидности и пропущенных дней на работе во всем мире. Боли в спине объясняют вторую наиболее распространенную причину посещения врача, превосходящую по численности лишь верхние респираторные инфекции. Примерно 80 процентов населения будут испытывать боли в спине, по крайней мере, один раз на протяжении всей их жизни. Позвоночник представляет собой сложную структуру, состоящую из костей, суставов, связок и мышц, среди других мягких тканей. Из-за этого травмы и / или усугубляемые условия, такие как грыжа межпозвоночных дисков, может в конечном итоге привести к симптомам боли в спине. Спортивные травмы или автомобильные травмы часто являются наиболее частыми причинами боли в спине, однако иногда самые простые движения могут иметь болезненные результаты. К счастью, альтернативные варианты лечения, такие как уход за хиропрактикой, могут помочь облегчить боль в спине с помощью спинальных регулировок и ручных манипуляций, что в конечном итоге улучшит облегчение боли.

изображение блога мультяшного бумажного мальчика

EXTRA EXTRA | ВАЖНАЯ ТЕМА: Рекомендуемый El Paso, TX Chiropractor

***